pAAV-Ef1a-DO-hChR2(H134R)-mCherry-WPRE-pA
(Plasmid #37082)

• Purpose: Cre-dependent expression of hChR2(H134R) for optogenetic excitation
• Depositing Lab: Bernardo Sabatini
• Publication: Kozorovitskiy et al Nature. 2012 May 13;485(7400):646-50. doi: 10.1038/nature11052.

Backbone

• Vector backbone: pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA
• Backbone manufacturer: K. Deisseroth Lab
• Backbone size w/o insert (bp): 5613
• Total vector size (bp): 7260
• Vector type: AAV, Cre/Lox ; Cre-Off

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: hChr2(H134R)-mCherry
• Species: Synthetic
• Insert Size (bp): 1647
• Promoter: EF1a
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Asc1 (unknown if destroyed)
• 3′ cloning site: Nhe1 (unknown if destroyed)
• 5′ sequencing primer: CTTCCATTTCAGGTGTCGTG
• 3′ sequencing primer: GCAGCGTATCCACATAGCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Karl Deisseroth Lab, Stanford Univ.
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry