Lenti-Hb9-RFP
(Plasmid #37081)

• Depositing Lab: Fred Gage
• Publication: Marchetto et al Cell Stem Cell. 2008 Dec 4;3(6):649-57.

Backbone

• Vector backbone: CSCspPW
• Backbone manufacturer: Inder Verma lab
• Backbone size w/o insert (bp): 8466
• Total vector size (bp): 12486
• Modifications to backbone: none
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Hb9 RFP
• Species: M. musculus (mouse)
• Insert Size (bp): 4020
• Promoter: Hb9

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ClaI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GCTAGCTCCGGAGAGCAAAAGCTG
• 3′ sequencing primer: TGTAATCCAGAGGTTGATTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Dr. Sam Pfaff
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Expresses RFP under the control of the Hb9 promoter to visualize postmitotic human motor neurons