pLKO-puro-sh-mFAK B
(Plasmid #37018)

• Depositing Lab: Bob Weinberg
• Publication: Shibue et al Proc Natl Acad Sci U S A. 2009 Jun 23;106(25):10290-5. Epub 2009 Jun 5.

Backbone

• Vector backbone: pLKO.1 puro (Addgene plasmid 8453)
• Backbone manufacturer: Weinberg lab
• Backbone size w/o insert (bp): 7032
• Total vector size (bp): 7090
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sh-mFAK B
• Alt name: FAK
• Alt name: shRNA against mouse FAK
• gRNA/shRNA sequence: CCTGGCATCTTTGATATTATA
• Species: M. musculus (mouse)
• Entrez Gene: Ptk2 (a.k.a. FADK 1, FAK, FRNK, Fadk, p125FAK)
• Promoter: hU6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: LKO.1 5'

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry