FLAG-EglN2-pLenti6
(Plasmid #36950)

• Depositing Lab: William Kaelin
• Publication: Koivunen et al Nature. 2012 Feb 15;483(7390):484-8. doi: 10.1038/nature10898.

Backbone

• Vector backbone: pLenti6
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 6886
• Total vector size (bp): 8122
• Modifications to backbone: the plenti6-V5 GW LacZ backbone of Invitrogen was modified to delete the original lacz ORF as well as attR sites and V5-tag and replaced with the Flag-ORF
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EglN2
• Species: H. sapiens (human)
• Insert Size (bp): 1236
• Mutation: Wildtype
• Entrez Gene: EGLN2 (a.k.a. EIT-6, EIT6, HIF-PH1, HIFPH1, HPH-1, HPH-3, PHD1)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xba I (not destroyed)
• 3′ cloning site: EcoR I (not destroyed)
• 5′ sequencing primer: CMV-forward
• 3′ sequencing primer: ACACCTGGTTGCTGACTAAT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

this plasmid was constructed in the lab of a HHMI-investigator