Skip to main content
Addgene

FLAG-EglN1-pLenti6
(Plasmid #36949)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36949 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti6
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 6873
  • Total vector size (bp) 8180
  • Modifications to backbone
    the plenti6-V5 GW LacZ backbone of Invitrogen was modified to delete the original lacz ORF as well as attR sites and V5-tag and replaced with the Flag-ORF
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EglN1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1307
  • Mutation
    Wildtype
  • Entrez Gene
    EGLN1 (a.k.a. C1orf12, ECYT3, HALAH, HIF-PH2, HIFPH2, HPH-2, HPH2, PHD2, SM20, ZMYND6)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba I (not destroyed)
  • 3′ cloning site EcoR I (not destroyed)
  • 5′ sequencing primer CMV-forward
  • 3′ sequencing primer ACACCTGGTTGCTGACTAAT
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

this plasmid was constructed in the lab of a HHMI-investigator

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FLAG-EglN1-pLenti6 was a gift from William Kaelin (Addgene plasmid # 36949)

  • For your References section:

    Transformation by the (R)-enantiomer of 2-hydroxyglutarate linked to EGLN activation. Koivunen P, Lee S, Duncan CG, Lopez G, Lu G, Ramkissoon S, Losman JA, Joensuu P, Bergmann U, Gross S, Travins J, Weiss S, Looper R, Ligon KL, Verhaak RG, Yan H, Kaelin WG Jr. Nature. 2012 Feb 15;483(7390):484-8. doi: 10.1038/nature10898. 10.1038/nature10898 PubMed 22343896
Related items: