FLAG-Venus-pLenti6
(Plasmid #36948)

• Depositing Lab: William Kaelin
• Publication: Koivunen et al Nature. 2012 Feb 15;483(7390):484-8. doi: 10.1038/nature10898.

Backbone

• Vector backbone: pLenti6
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 6887
• Total vector size (bp): 7611
• Modifications to backbone: the plenti6-V5 GW LacZ backbone of Invitrogen was modified to delete the original lacz ORF as well as attR sites and V5-tag and replaced with the Flag-ORF
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Venus (EYFP)
• Alt name: EYFP
• Species: Aequorea victoria
• Insert Size (bp): 724
• Mutation: -F46L/F64L/V68L/M153T/V163A/S175G
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xba I (not destroyed)
• 3′ cloning site: BamH I (not destroyed)
• 5′ sequencing primer: CMV-forward
• 3′ sequencing primer: ACACCTGGTTGCTGACTAAT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: received at Bunrham Institute; received from A. Miyawaki, Riken, Japan; original publication: Nagai T., Ibata K., Park E. S., Kubota M., Mikoshiba K., Miyawaki A.(2002) Nat. Biotechnol. 20:87–90.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

this plasmid was constructed in the laboratory of an HHMI investigator