ArcLight-S249
(Plasmid #36855)

• Depositing Lab: Vincent Pieribone
• Publication: Jin et al Neuron. 2012 Sep 6;75(5):779-85.

Backbone

• Vector backbone: pCS2+
• Backbone size w/o insert (bp): 5694
• Total vector size (bp): 7167
• Modifications to backbone: a hygromysin resistance gene was inserted to facilitate selection for stably transfected cells.
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: fluorescent protein voltage sensor
• Alt name: ArcLight
• Alt name: Ci-VSP
• Alt name: super ecliptic pHluorin
• Species: Ciona intestinalis
• Insert Size (bp): 1473
• Mutation: Ci-VSP contains R217Q mutation; super ecliptic pHluorin contains A227D mutation
• GenBank ID: AB183035 AY533296
• Promoter: simian CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GACGTAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TTAAAAAACCTCCCACACCTC

Resource Information

• Supplemental Documents:
  • ArcLight S249
• A portion of this plasmid was derived from a plasmid made by: Dr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

http://www.fluorogenetic-voltage-sensors.org/

This construct is composed of the S1-4 domain of the CiVSP voltage sensor. Super ecliptic pHluorin is inserted at position S249 in the CiVSP sequence.