pEGFP-C1-hAtg2A
(Plasmid #36456)

• Depositing Lab: Noboru Mizushima
• Publication: Velikkakath et al Mol Biol Cell. 2012 Mar;23(5):896-909. Epub 2012 Jan 4.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 10503
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: autophagy-related protein 2 homolog A
• Alt name: Atg2A
• Species: H. sapiens (human)
• Insert Size (bp): 5817
• Mutation: changed Proline 656 to Arginine
• GenBank ID: NM_015104
• Entrez Gene: ATG2A (a.k.a. BLTP4A)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGACCACTACCAGCAGAACA

Resource Information

• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry