pXL004-ishRNA-scramble
(Plasmid #36311)

• Depositing Lab: Sean Palecek
• Publication: Lian et al Proc Natl Acad Sci U S A. 2012 May 29.

Backbone

• Vector backbone: pLV-H1TetO-RFP-Puro
• Backbone manufacturer: Biosettia
• Backbone size w/o insert (bp): 10275
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: 18 hrs at 250 rpm
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: shRNA of scramble
• Alt name: scramble
• gRNA/shRNA sequence: GCTACACTATCGAGCAATT
• Insert Size (bp): 1008
• Promoter: TetO-H1
• Tag / Fusion Protein:
  • EF1a-TetR-IRES-RFP-Puro (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: AATATTTGCATGTCGCTATGTG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid backbone is TetO-H1-shRNA-EF1a-TetR-IRES-RFP-Puro. It is a all-in-one inducible shRNA knockdown lentiviral plasmid.

The paper associated with this plasmid is "Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling"