Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pXylan
(Plasmid #36301)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36301 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Biobrick family of vectors
  • Vector type
    Synthetic Biology
  • Selectable markers
    Amp

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Growth instructions
    Use Ampicillin EZ media. Promoters on this plasmid are strongly expressed in LB medium. Growth in minimal medium with glucose instead of LB, or EZ rich medium, may help with plasmid stability
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    pXylan
  • Insert Size (bp)
    7102
  • Promoter Two promoters from the E coli genome drive two different genes: PcspD and PcstA

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gacgtcggtgcctaatgagtg
  • 3′ sequencing primer tgcctggagatccttactcgagtt
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note from depositor regarding growing this plasmid: W used DH10B, plated on LB/carb, and grew the plasmid up in TB medium plus 2% glycerol and 100 ug/mL carbenicillin. It's key to not grow the cells up too long, either on the plate or in the liquid medium, and probably best to harvest the cells in early stationary phase.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXylan was a gift from Jay Keasling (Addgene plasmid # 36301 ; http://n2t.net/addgene:36301 ; RRID:Addgene_36301)
  • For your References section:

    Synthesis of three advanced biofuels from ionic liquid-pretreated switchgrass using engineered Escherichia coli. Bokinsky G, Peralta-Yahya PP, George A, Holmes BM, Steen EJ, Dietrich J, Soon Lee T, Tullman-Ercek D, Voigt CA, Simmons BA, Keasling JD. Proc Natl Acad Sci U S A. 2011 Dec 13;108(50):19949-54. Epub 2011 Nov 28. 10.1073/pnas.1106958108 PubMed 22123987