pXylan
(Plasmid #36301)

• Depositing Lab: Jay Keasling
• Publication: Bokinsky et al Proc Natl Acad Sci U S A. 2011 Dec 13;108(50):19949-54. Epub 2011 Nov 28.

Backbone

• Vector backbone: Biobrick family of vectors
• Vector type: Synthetic Biology
• Selectable markers: Amp

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Growth instructions: Use Ampicillin EZ media. Promoters on this plasmid are strongly expressed in LB medium. Growth in minimal medium with glucose instead of LB, or EZ rich medium, may help with plasmid stability
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: pXylan
• Insert Size (bp): 7102
• Promoter: Two promoters from the E coli genome drive two different genes: PcspD and PcstA

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gacgtcggtgcctaatgagtg
• 3′ sequencing primer: tgcctggagatccttactcgagtt

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note from depositor regarding growing this plasmid: W used DH10B, plated on LB/carb, and grew the plasmid up in TB medium plus 2% glycerol and 100 ug/mL carbenicillin. It's key to not grow the cells up too long, either on the plate or in the liquid medium, and probably best to harvest the cells in early stationary phase.