pXL002-ishRNA-beta-catenin-1
(Plasmid #36297)

• Depositing Lab: Sean Palecek
• Publication: Lian et al Proc Natl Acad Sci U S A. 2012 May 29.

Backbone

• Vector backbone: pLV-H1TetO-RFP-Puro
• Backbone manufacturer: Biosettia
• Backbone size w/o insert (bp): 10275
• Modifications to backbone: insert the shRNA of beta-catenin
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: 18 hours at 250 rpm
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: shRNA of beta-catenin-1
• Alt name: CTNNB1
• gRNA/shRNA sequence: GCATAACCTTTCCCATCAT
• Species: H. sapiens (human)
• Insert Size (bp): 1008
• Entrez Gene: CTNNB1 (a.k.a. CTNNB, EVR7, MRD19, NEDSDV, armadillo)
• Promoter: TetO-H1
• Tag / Fusion Protein:
  • IRES-RFP-Puro (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: AATATTTGCATGTCGCTATGTG

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry