Skip to main content
Addgene

pCY 3110-01
(Plasmid #36236)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 36236 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pBS7
  • Backbone manufacturer
    Yeast Resource Center, University of Washington
  • Backbone size w/o insert (bp) 4882
  • Vector type
    Yeast cassette for PCR and homologous recombination
  • Selectable markers
    Geneticin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5alpha used for DNA recovery of plasmid (i.e. DNA preps).
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mEos2
  • Insert Size (bp)
    708
  • Tag / Fusion Protein
    • yEpolylinker-mEos2-kanMX (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BssHII (unknown if destroyed)
  • 5′ sequencing primer CCTTATGTATCATACACATACG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid 20341 (McKinney, S. A., Murphy, C. S., Hazelwood, K. L., Davidson, M. W. and Looger, L. L. (2009). A bright and photostable photoconvertible fluorescent protein. Nat Methods 6, 131-3.)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCY 3110-01 was a gift from Anne Robinson (Addgene plasmid # 36236 ; http://n2t.net/addgene:36236 ; RRID:Addgene_36236)
  • For your References section:

    Cassette series designed for live-cell imaging of proteins and high-resolution techniques in yeast. Young CL, Raden DL, Caplan JL, Czymmek KJ, Robinson AS. Yeast. 2012 Mar;29(3-4):119-36. doi: 10.1002/yea.2895. Epub 2012 Apr 4. 10.1002/yea.2895 PubMed 22473760