pCY 3090-07
(Plasmid #36232)

• Depositing Lab: Anne Robinson
• Publication: Young et al Yeast. 2012 Mar;29(3-4):119-36. doi: 10.1002/yea.2895. Epub 2012 Apr 4.

Backbone

• Vector backbone: pCY 3090-02
• Vector type: Yeast cassette for PCR and homologous recombination
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: DH5alpha used for DNA recovery of plasmid (i.e. DNA preps).
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Streptoalloteichus hindustanus bleomycin (Sh ble)
• Species: Streptoalloteichus hindustanus
• Insert Size (bp): 970
• Tag / Fusion Protein:
  • yEpolylinker-mCherry-Zeocin (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (unknown if destroyed)
• 3′ cloning site: SacI (unknown if destroyed)
• 5′ sequencing primer: CACCATCGTGGAACAGTACG

Resource Information

• Supplemental Documents:
  • Theoretical sequence
• A portion of this plasmid was derived from a plasmid made by: pPICZ (invitrogen); however, the parental vector contains mCherry for which a MTA is needed (R. Tsien lab) -please see http://depts.washington.edu/yeastrc/pages/pBS35.html
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry