pCY 3070-01
(Plasmid #36225)

• Depositing Lab: Anne Robinson
• Publication: Young et al Yeast. 2012 Mar;29(3-4):119-36. doi: 10.1002/yea.2895. Epub 2012 Apr 4.

Backbone

• Vector backbone: pBS7
• Backbone manufacturer: Yeast Resource Center, University of Washington
• Backbone size w/o insert (bp): 4882
• Vector type: Yeast cassette for PCR and homologous recombination
• Selectable markers: Geneticin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: DH5alpha used for DNA recovery of plasmid (i.e. DNA preps).
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: yECitrine
• Insert Size (bp): 768
• Tag / Fusion Protein:
  • yEpolylinker-yECitrine-kanMX (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: BssHII (unknown if destroyed)
• 5′ sequencing primer: CCTTATGTATCATACACATACG

Resource Information

• Supplemental Documents:
  • Theoretical sequence
• A portion of this plasmid was derived from a plasmid made by: Addgene plasmid 8737 (Sheff, M. A. and Thorn, K. S. (2004). Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast 21, 661-70.)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry