pCY 3050-06
(Plasmid #36222)

• Depositing Lab: Anne Robinson
• Publication: Young et al Yeast. 2012 Mar;29(3-4):119-36. doi: 10.1002/yea.2895. Epub 2012 Apr 4.

Backbone

• Vector backbone: pBS7
• Backbone manufacturer: Yeast Resource Center, University of Washington
• Backbone size w/o insert (bp): 4882
• Vector type: Yeast cassette for PCR and homologous recombination
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: DH5alpha used for DNA recovery of plasmid (i.e. DNA preps).
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: URA3
• Insert Size (bp): 1220
• Tag / Fusion Protein:
  • yEpolylinker-Venus-URA3 (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (unknown if destroyed)
• 3′ cloning site: SacI (unknown if destroyed)
• 5′ sequencing primer: GGTCTTGTTAGAATTTGTTACTGC

Resource Information

• Supplemental Documents:
  • Theoretical sequence
• A portion of this plasmid was derived from a plasmid made by: URA3 was amplified from pRS316 (Sikorski, R. S. and Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27.)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

The minor discrepancies between the Addgene and author's sequence do not affect the plasmid function.