Skip to main content
Addgene

pCY 3010-05
(Plasmid #36211)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36211 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCY3010-02
  • Vector type
    Yeast cassette for PCR and homologous recombination
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5alpha used for DNA recovery of plasmid (i.e. DNA preps).
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LEU2
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2247
  • Tag / Fusion Protein
    • yEpolylinker-Cerulean-LEU2 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (unknown if destroyed)
  • 3′ cloning site SacI (unknown if destroyed)
  • 5′ sequencing primer CGAAAAGAGAGACCACATGGTCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    LEU2 was amplified from pRS315 (Sikorski, R. S. and Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27.)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCY 3010-05 was a gift from Anne Robinson (Addgene plasmid # 36211 ; http://n2t.net/addgene:36211 ; RRID:Addgene_36211)
  • For your References section:

    Cassette series designed for live-cell imaging of proteins and high-resolution techniques in yeast. Young CL, Raden DL, Caplan JL, Czymmek KJ, Robinson AS. Yeast. 2012 Mar;29(3-4):119-36. doi: 10.1002/yea.2895. Epub 2012 Apr 4. 10.1002/yea.2895 PubMed 22473760