pCY 3010-02
(Plasmid #36210)

• Depositing Lab: Anne Robinson
• Publication: Young et al Yeast. 2012 Mar;29(3-4):119-36. doi: 10.1002/yea.2895. Epub 2012 Apr 4.

Backbone

• Vector backbone: pBS10
• Backbone manufacturer: Yeast Resource Center, University of Washington
• Backbone size w/o insert (bp): 4875
• Vector type: Yeast cassette for PCR and homologous recombination
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: DH5alpha used for DNA recovery of plasmid (i.e. DNA preps).
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: yeast-enhanced (yE) polylinker
• Species: S. cerevisiae (budding yeast)
• Tag / Fusion Protein:
  • yEpolylinker-Cerulean-hphMX4 (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XmaI (unknown if destroyed)
• 3′ cloning site: PacI (unknown if destroyed)
• 5′ sequencing primer: CCTTATGTATCATACACATACG

Resource Information

• Supplemental Documents:
  • Theoretical sequence
• A portion of this plasmid was derived from a plasmid made by: The yeast-enhanced polylinker (i.e. insert) was synthesized; however, the parental vector pBS10 was received from the Yeast Resource Center, University of Washington.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry