pCMV-calpainsensor
(Plasmid #36182)

• Purpose: detection of activity of ubiquitous calpains
• Depositing Lab: Isabelle Richard
• Publication: Stockholm et al J Mol Biol. 2005 Feb 11;346(1):215-22. Epub 2004 Dec 16.

Backbone

• Vector backbone: peYFP
• Backbone manufacturer: Clontech
• Total vector size (bp): 5456
• Modifications to backbone: Plasmids peYFP and peCFP were obtained from Clontech. pTOM plasmid, containing eYFP and eCFP, respectively, in 5′ and 3′ of the multi-cloning site was obtained after digestion of peYFP and peCFP by XhoI and HpaI and religation of the eCFP fragment in peYFP. pCalpain-sensor was obtained by digestion of pTOM with BspeI and BamHI and ligation of the following primers: 5′-PCCGGAAGCGGCCAGCAGGAGGTGTATGGTGCGATGCCCAGGGATGGCTCAGGG-3′ and 5′-P-GATCCCCTGAGCCATCCCAGGGCATAGCACCATACACCTCCTGCTGGCCGCTT-3′, which encode the linkers and the mouse α-fodrin cleavage site by ubiquitous calpains. The peptide sequence of the linker and the α-fodrin cleavage site is GSG-QQEVY GAMPRDGSG. GSG corresponds to linker sequences
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: alpha-Fodrin cleavage site
• Alt name: calpain sensor
• Alt name: EYFP--calpain clevage site from alpha-Fodrin--ECFP
• Species: M. musculus (mouse)
• Insert Size (bp): 53
• Entrez Gene: Sptan1 (a.k.a. 2610027H02Rik, Spna-2, Spna2)
• Promoter: CMV
• Tags / Fusion Proteins:
  • eYFP (N terminal on insert)
  • eCFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bspe1 (not destroyed)
• 3′ cloning site: BamH1 (not destroyed)
• 5′ sequencing primer: CMV-F
• 3′ sequencing primer: SV40pA-R

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry