Skip to main content
Addgene

YFP Gamma 9
(Plasmid #36107)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36107 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 6373
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    G protein subunit Gamma 9
  • Alt name
    GNG9
  • Species
    B. taurus (bovine)
  • Insert Size (bp)
    210
  • Mutation
    HIs tag between YFP and insert
  • GenBank ID
  • Promoter CMV
  • Tag / Fusion Protein
    • YFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer TTAATACGACTCACTATAGGG
  • 3′ sequencing primer GGAGGGGCAAACAACAGATGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    YFP Gamma 9 was a gift from Narasimhan Gautam (Addgene plasmid # 36107 ; http://n2t.net/addgene:36107 ; RRID:Addgene_36107)
  • For your References section:

    A family of G protein betagamma subunits translocate reversibly from the plasma membrane to endomembranes on receptor activation. Saini DK, Kalyanaraman V, Chisari M, Gautam N. J Biol Chem. 2007 Aug 17;282(33):24099-108. Epub 2007 Jun 20. 10.1074/jbc.M701191200 PubMed 17581822