Addgene: pAAV asyn S87D/S129A Skip to main content
Addgene

pAAV asyn S87D/S129A
(Plasmid #36071)

Full plasmid sequence is not available for this item.

Created with RaphaëlpAAV asyn S87D/S129ABglIIalpha-synuclein…ClaI

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36071 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4581
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    alpha-synuclein S87D/S129A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    484
  • Mutation
    S87D/S129A
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer bglob fw (TCTTATCTTCCTCCCACAGC)
  • 3′ sequencing primer hGH rev (TAGGACAAGGCTGGTGGGCA)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Lashuel Lab Plasmid #166

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV asyn S87D/S129A was a gift from Patrick Aebischer & Hilal Lashuel (Addgene plasmid # 36071 ; http://n2t.net/addgene:36071 ; RRID:Addgene_36071)