pAAV asyn S87E
(Plasmid
#36057)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 36057 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4581
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namealpha-synuclein S87E
-
SpeciesH. sapiens (human)
-
Insert Size (bp)484
-
MutationS87E
-
Entrez GeneSNCA (a.k.a. NACP, PARK1, PARK4, PD1)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer bglob fw (TCTTATCTTCCTCCCACAGC)
- 3′ sequencing primer hGH rev (TAGGACAAGGCTGGTGGGCA) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lashuel Lab Plasmid #206
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV asyn S87E was a gift from Hilal Lashuel (Addgene plasmid # 36057 ; http://n2t.net/addgene:36057 ; RRID:Addgene_36057) -
For your References section:
Mimicking phosphorylation at serine 87 inhibits the aggregation of human alpha-synuclein and protects against its toxicity in a rat model of Parkinson's disease. Oueslati A, Paleologou KE, Schneider BL, Aebischer P, Lashuel HA. J Neurosci. 2012 Feb 1;32(5):1536-44. 10.1523/JNEUROSCI.3784-11.2012 PubMed 22302797