Skip to main content
Addgene

pAAV asyn WT
(Plasmid #36055)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36055 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4581
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    alpha-synuclein WT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    484
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer bglob fw (TCTTATCTTCCTCCCACAGC)
  • 3′ sequencing primer hGH rev (TAGGACAAGGCTGGTGGGCA)
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Lashuel Lab Plasmid #172

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV asyn WT was a gift from Hilal Lashuel (Addgene plasmid # 36055 ; http://n2t.net/addgene:36055 ; RRID:Addgene_36055)

  • For your References section:

    Mimicking phosphorylation at serine 87 inhibits the aggregation of human alpha-synuclein and protects against its toxicity in a rat model of Parkinson's disease. Oueslati A, Paleologou KE, Schneider BL, Aebischer P, Lashuel HA. J Neurosci. 2012 Feb 1;32(5):1536-44. 10.1523/JNEUROSCI.3784-11.2012 PubMed 22302797
Related items:
Commonly requested with: