pT7-7 asyn S129E
(Plasmid #36050)

• Depositing Lab: Hilal Lashuel
• Publication: Paleologou et al J Biol Chem. 2008 Jun 13;283(24):16895-905. Epub 2008 Mar 14.

Backbone

• Vector backbone: pT7-7
• Backbone size w/o insert (bp): 2438
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: alpha-synuclein S129E
• Species: H. sapiens (human)
• Insert Size (bp): 476
• Mutation: S129E
• Entrez Gene: SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: T7
• 3′ sequencing primer: AmpStop (TCAGGCAACTATGGATGAAC)

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Lashuel Lab Plasmid #78