-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36035 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmCherry-1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4140
-
Modifications to backboneXhoI and BamHI cleaved, removing intervening sequence in the MCS.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCHOP promoter (-647 to +136)
-
Alt nameCHOP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)787
-
GenBank IDNT_029419.12 NM_001195053
-
Entrez GeneDDIT3 (a.k.a. AltDDIT3, C/EBPzeta, CEBPZ, CHOP, CHOP-10, CHOP10, GADD153)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer custom: GGCCTTTTGCTCACATGTTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOriginal human CHOP promoter (-647 to +91) obtained from Pierre Fafournoux. Bruhat, A., Jousse, C., Carraro, V., Reimold, A. M., Ferrara, M., and Fafournoux, P. (2000) Amino acids control mammalian gene transcription. Activating transcription factor 2 is essential for the amino acid responsiveness of the CHOP promoter. Mol. Cell. Biol. 20, 7192–7204
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CHOP promoter (-649/+136) pmCherry-1 was a gift from Quan Lu (Addgene plasmid # 36035 ; http://n2t.net/addgene:36035 ; RRID:Addgene_36035) -
For your References section:
Functional RNA Interference (RNAi) Screen Identifies System A Neutral Amino Acid Transporter 2 (SNAT2) as a Mediator of Arsenic-induced Endoplasmic Reticulum Stress. Oh RS, Pan WC, Yalcin A, Zhang H, Guilarte TR, Hotamisligil GS, Christiani DC, Lu Q. J Biol Chem. 2012 Feb 17;287(8):6025-34. Epub 2012 Jan 3. 10.1074/jbc.M111.311217 PubMed 22215663