CHOP promoter (-649/+136) pmCherry-1
(Plasmid #36035)

• Depositing Lab: Quan Lu
• Publication: Oh et al J Biol Chem. 2012 Feb 17;287(8):6025-34. Epub 2012 Jan 3.

Backbone

• Vector backbone: pmCherry-1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4140
• Modifications to backbone: XhoI and BamHI cleaved, removing intervening sequence in the MCS.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CHOP promoter (-647 to +136)
• Alt name: CHOP
• Species: H. sapiens (human)
• Insert Size (bp): 787
• GenBank ID: NT_029419.12 NM_001195053
• Entrez Gene: DDIT3 (a.k.a. AltDDIT3, C/EBPzeta, CEBPZ, CHOP, CHOP-10, CHOP10, GADD153)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: custom: GGCCTTTTGCTCACATGTTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Original human CHOP promoter (-647 to +91) obtained from Pierre Fafournoux. Bruhat, A., Jousse, C., Carraro, V., Reimold, A. M., Ferrara, M., and Fafournoux, P. (2000) Amino acids control mammalian gene transcription. Activating transcription factor 2 is essential for the amino acid responsiveness of the CHOP promoter. Mol. Cell. Biol. 20, 7192–7204
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry