pCDNA 3.1 Flag-rat-PTP1B
(Plasmid #35988)

• Depositing Lab: Anna Huttenlocher
• Publication: Cortesio et al J Cell Biol. 2008 Mar 10;180(5):957-71.

Backbone

• Vector backbone: pcDNA3.1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5427
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: protein tyrosine phosphatase 1B
• Alt name: PTP1B
• Species: R. norvegicus (rat)
• Insert Size (bp): 1299
• Entrez Gene: Ptpn1 (a.k.a. Ptp)
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: Not I (not destroyed)
• 5′ sequencing primer: T7 FWD TAATACGACTCACTATAGGG
• 3′ sequencing primer: BGH Rev CCTCGACTGTGCCTTCTA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: (EGFP)-PTP1B-HA construct was a gift from C. Arregui (University of San Martin, Buenos Aires, Argentina)
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A Kozak methionine initiator sequence and a Flag tag were added to the N terminus of rat PTP1B, which was amplified by PCR with the following primers: 5′-CTCGGATCCGCCACCATGGACTACAAGGACGACGATGACAAGAAGCTTGGGATGGAAATGGAGAAGGAATTCGAG-3′ and 5′-CTCTAGACTCGAGCGGCCGCTCAGTGAAAACATACCCGGTAACAG-3′. The PCR product was digested with BamHI and NotI and subsequently ligated into the corresponding sites of pCDNA3.1(+) (Invitrogen)

Please note that Addgene's sequencing results differ from the full plasmid sequence information from the depositing laboratory at bp# 889-910, indicating that the NheI and AflII sites are no longer present in the plasmid.