Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTrcHisA-rat-PTP1B
(Plasmid #35987)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35987 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTrcHis A
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4407
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    protein tyrosine phosphatase 1B
  • Alt name
    PTP1B
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1299
  • Entrez Gene
    Ptpn1 (a.k.a. Ptp)
  • Tags / Fusion Proteins
    • His (N terminal on insert)
    • Xpress Epitope Tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH I (not destroyed)
  • 3′ cloning site Bgl II (not destroyed)
  • 5′ sequencing primer pTrcHis fwd GAGGTATATATTAATGTATCG
  • 3′ sequencing primer pTrcHis rev CCTGATACAGATTAAATC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GFP (EGFP)-PTP1B-HA construct was a gift from C. Arregui (University of San Martin, Buenos Aires, Argentina)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTrcHisA-rat-PTP1B was a gift from Anna Huttenlocher (Addgene plasmid # 35987 ; http://n2t.net/addgene:35987 ; RRID:Addgene_35987)
  • For your References section:

    Calpain 2 and PTP1B function in a novel pathway with Src to regulate invadopodia dynamics and breast cancer cell invasion. Cortesio CL, Chan KT, Perrin BJ, Burton NO, Zhang S, Zhang ZY, Huttenlocher A. J Cell Biol. 2008 Mar 10;180(5):957-71. 10.1083/jcb.200708048 PubMed 18332219