pBR.DT-A
(Plasmid #35955)

• Depositing Lab: Jacqueline Lees
• Publication: Danielian et al Oncogene. 2008 Nov 20;27(51):6561-70. Epub 2008 Jul 28.

Backbone

• Vector backbone: pBR322
• Backbone manufacturer: New England Biolabs
• Backbone size w/o insert (bp): 4300
• Vector type: BAC recombineering
• Selectable markers: diphtheria toxin A

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: diphtheria toxin A
• Alt name: DT-A
• Promoter: PGK

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BssHII/StyI -> Resulting site can be cut with BssHII (not destroyed)
• 3′ cloning site: BssHII/EcoRV (destroyed during cloning)
• 5′ sequencing primer: mPGK_F_primer
• 3′ sequencing primer: BGH rev

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Part of the sequence (the polylinker and the DT A cassette) was derived from Addgene plasmid# 19030 from Tyler Jacks lab.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid can be used for gap-repair mediated recovery of DNA sequences from BACs using recombineering technology and for gene targeting. It contains a eukaryotic diphtheria toxin A expression cassette driven by the PGK promoter and a modified polylinker cloned into the low copy number plasmid pBR322.

There are 8-base pair restriction enzyme sites for PacI, PmeI and SfiI in the polylinker.

The depositing lab has used these sequences as the homology sequences for amplifying the plasmid for gap repair:

5' CGATACCGTCGACCTCGAGG 3'
5' GCTTGATATCGAATTCTACC 3'