pAAV TBG FFluc miR122sponge
(Plasmid #35657)

• Depositing Lab: Phillip Zamore
• Publication: Xie et al Nat Methods. 2012 Mar 4;9(4):403-9. doi: 10.1038/nmeth.1903.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV TBG FFluc
• Backbone size w/o insert (bp): 5915
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: miR-122 sponge
• Species: Synthetic
• Insert Size (bp): 156
• Promoter: TBG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR V (destroyed during cloning)
• 3′ cloning site: Apa I (not destroyed)
• 5′ sequencing primer: tgttgttttggagcacggaaaga

Resource Information

• Supplemental Documents:
  • VNTI map of pAAV TBG FFluc miR122sponge

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that there is a 4bp deletion in Addgene's quality control sequence when compared to depositor's reference sequence. This deletion will not affect plasmid function.