Skip to main content
Addgene

pAAV TBG FFluc miR122sponge
(Plasmid #35657)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35657 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV TBG FFluc
  • Backbone size w/o insert (bp) 5915
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miR-122 sponge
  • Species
    Synthetic
  • Insert Size (bp)
    156
  • Promoter TBG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR V (destroyed during cloning)
  • 3′ cloning site Apa I (not destroyed)
  • 5′ sequencing primer tgttgttttggagcacggaaaga
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that there is a 4bp deletion in Addgene's quality control sequence when compared to depositor's reference sequence. This deletion will not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV TBG FFluc miR122sponge was a gift from Phillip Zamore (Addgene plasmid # 35657 ; http://n2t.net/addgene:35657 ; RRID:Addgene_35657)

  • For your References section:

    Long-term, efficient inhibition of microRNA function in mice using rAAV vectors. Xie J, Ameres SL, Friedline R, Hung JH, Zhang Y, Xie Q, Zhong L, Su Q, He R, Li M, Li H, Mu X, Zhang H, Broderick JA, Kim JK, Weng Z, Flotte TR, Zamore PD, Gao G. Nat Methods. 2012 Mar 4;9(4):403-9. doi: 10.1038/nmeth.1903. 10.1038/nmeth.1903 PubMed 22388288
Related items:
Commonly requested with: