Skip to main content
Addgene

pAAVf-EnhCB-lacZnls mir-122 1xBS
(Plasmid #35643)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35643 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAVf-EnhCB-lacZnls
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    1 miR-122 target site
  • Species
    Synthetic
  • Insert Size (bp)
    23
  • Promoter CB

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstB I (not destroyed)
  • 3′ cloning site BstB I (not destroyed)
  • 5′ sequencing primer TGAAGCTGAAGCCTGTGATG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAVf-EnhCB-lacZnls mir-122 1xBS was a gift from Phillip Zamore (Addgene plasmid # 35643 ; http://n2t.net/addgene:35643 ; RRID:Addgene_35643)

  • For your References section:

    Long-term, efficient inhibition of microRNA function in mice using rAAV vectors. Xie J, Ameres SL, Friedline R, Hung JH, Zhang Y, Xie Q, Zhong L, Su Q, He R, Li M, Li H, Mu X, Zhang H, Broderick JA, Kim JK, Weng Z, Flotte TR, Zamore PD, Gao G. Nat Methods. 2012 Mar 4;9(4):403-9. doi: 10.1038/nmeth.1903. 10.1038/nmeth.1903 PubMed 22388288
Related items: