pGL3-321/+120 Ebox mut2
(Plasmid #35545)

• Depositing Lab: Greg Goodall
• Publication: Bracken et al Cancer Res. 2008 Oct 1;68(19):7846-54.

Backbone

• Vector backbone: pGL3-basic
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 5250
• Vector type: Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: promoter region of miR200b-200a-429 genomic cluster
• Alt name: MIRN200B
• Alt name: MIRN200A
• Alt name: MIRN429
• Species: H. sapiens (human)
• Insert Size (bp): 441
• Mutation: T to G at position -52 in promoter
• GenBank ID: 406984 406983
• Entrez Gene: MIR200B (a.k.a. MIRN200B, mir-200b)
• Entrez Gene: MIR429 (a.k.a. MIRN429, hsa-mir-429, mir-429)
• Entrez Gene: MIR200A (a.k.a. MIRN200A, mir-200a)
• Promoter: none
• Tag / Fusion Protein:
  • luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: CTAGCAAAATAGGCTGTCCC
• 3′ sequencing primer: CTTTATGTTTTTGGCGTCTTCCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene's sequencing results identified a single nucleotide mismatch at bp# 210 when compared to the full plasmid sequence provided by the depositing laboratory. This mismatch is not known to affect the function of the plasmid.