pLenti-CaMKIIa-C1C2-EYFP
(Plasmid
#35519)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 35519 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti-CaMKIIa
- Backbone size w/o insert (bp) 9226
-
Modifications to backboneHas a CaMKIIa promoter and a WPRE
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChR1-ChR2 Chimera
-
Alt nameC1C2
-
SpeciesChlamydomonas reinhardtii
-
Insert Size (bp)1770
- Promoter CaMKIIa
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AGTCCTGCAGTATTGTGTAT
- 3′ sequencing primer GCAATAGCATGATACAAAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-CaMKIIa-C1C2-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 35519 ; http://n2t.net/addgene:35519 ; RRID:Addgene_35519) -
For your References section:
Crystal structure of the channelrhodopsin light-gated cation channel. Kato HE, Zhang F, Yizhar O, Ramakrishnan C, Nishizawa T, Hirata K, Ito J, Aita Y, Tsukazaki T, Hayashi S, Hegemann P, Maturana AD, Ishitani R, Deisseroth K, Nureki O. Nature. 2012 Jan 22. doi: 10.1038/nature10870. 10.1038/nature10870 PubMed 22266941