Skip to main content
Addgene

pLenti-CaMKIIa-C1C2-EYFP
(Plasmid #35519)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35519 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti-CaMKIIa
  • Backbone size w/o insert (bp) 9226
  • Modifications to backbone
    Has a CaMKIIa promoter and a WPRE
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChR1-ChR2 Chimera
  • Alt name
    C1C2
  • Species
    Chlamydomonas reinhardtii
  • Insert Size (bp)
    1770
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGTCCTGCAGTATTGTGTAT
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CaMKIIa-C1C2-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 35519 ; http://n2t.net/addgene:35519 ; RRID:Addgene_35519)
  • For your References section:

    Crystal structure of the channelrhodopsin light-gated cation channel. Kato HE, Zhang F, Yizhar O, Ramakrishnan C, Nishizawa T, Hirata K, Ito J, Aita Y, Tsukazaki T, Hayashi S, Hegemann P, Maturana AD, Ishitani R, Deisseroth K, Nureki O. Nature. 2012 Jan 22. doi: 10.1038/nature10870. 10.1038/nature10870 PubMed 22266941