pAAV-CaMKIIa-eArch 3.0-EYFP
(Plasmid #35516)

• Purpose: AAV expression of CaMKIIa-driven Arch 3.0 for optical inhibition.
• Depositing Lab: Karl Deisseroth
• Publication: Mattis et al Nat Methods. 2011 Dec 18;9(2):159-72. doi: 10.1038/nmeth.1808.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5379
• Modifications to backbone: Addition of CaMKIIa promoter and a WPRE
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Arch3.0-EYFP
• Species: H. sodomense
• Insert Size (bp): 1601
• Mutation: Enhanced trafficking signal and ER export signal added
• Promoter: CaMKIIa
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: AGTCCTGCAGTATTGTGTAT
• 3′ sequencing primer: GCAATAGCATGATACAAAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This is modified pLenti-CaMKIIa-Arch-GFP deposited at Addgene by the Boyden Lab.
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The enhanced trafficking signals allow for better membrane targeting in mammalian cells resulting in 3-5 fold increase in currents.