Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-CaMKIIa-eArch 3.0-EYFP
(Plasmid #35516)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35516 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5379
  • Modifications to backbone
    Addition of CaMKIIa promoter and a WPRE
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Arch3.0-EYFP
  • Species
    H. sodomense
  • Insert Size (bp)
    1601
  • Mutation
    Enhanced trafficking signal and ER export signal added
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGTCCTGCAGTATTGTGTAT
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This is modified pLenti-CaMKIIa-Arch-GFP deposited at Addgene by the Boyden Lab.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The enhanced trafficking signals allow for better membrane targeting in mammalian cells resulting in 3-5 fold increase in currents.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-eArch 3.0-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 35516 ; http://n2t.net/addgene:35516 ; RRID:Addgene_35516)
  • For your References section:

    Principles for applying optogenetic tools derived from direct comparative analysis of microbial opsins. Mattis J, Tye KM, Ferenczi EA, Ramakrishnan C, O'Shea DJ, Prakash R, Gunaydin LA, Hyun M, Fenno LE, Gradinaru V, Yizhar O, Deisseroth K. Nat Methods. 2011 Dec 18;9(2):159-72. doi: 10.1038/nmeth.1808. 10.1038/nmeth.1808 PubMed 22179551