pLenti-CaMKIIa-Mac 3.0-EYFP
(Plasmid #35515)

• Purpose: Lentiviral expression of CaMKIIa-driven Mac 3.0 for optical inhibition.
• Depositing Lab: Karl Deisseroth
• Publication: Mattis et al Nat Methods. 2011 Dec 18;9(2):159-72. doi: 10.1038/nmeth.1808.

Backbone

• Vector backbone: pLenti
• Backbone size w/o insert (bp): 9245
• Modifications to backbone: Addition of a CaMKIIa promoter and a WPRE
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eMac 3.0-EYFP
• Species: L. maculans
• Insert Size (bp): 1766
• Mutation: Trafficking signal, ER export
• Promoter: CaMKIIa
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: AGTCCTGCAGTATTGTGTAT
• 3′ sequencing primer: GCAATAGCATGATACAAAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This is modified pLenti-CaMKIIa-Mac-GFP deposited at Addgene by the Boyden Lab.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The enhanced trafficking signals allow for better membrane targeting in mammalian cells resulting in 3-5 fold increase in currents.

Please note that there may be several sequence discrepancies between depositor's reference sequence and Addgene's quality control sequence. These changes are in vector regions only and should not affect plasmid function.