pAAV-CaMKIIa-hChR2(E123T/T159C)-EYFP
(Plasmid #35511)

• Purpose: AAV expression of CaMKIIa-driven hChR2 variant for ultrafast optogenetic control.
• Depositing Lab: Karl Deisseroth
• Publication: Mattis et al Nat Methods. 2011 Dec 18;9(2):159-72. doi: 10.1038/nmeth.1808.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5385
• Modifications to backbone: Addition of a CaMKIIa promoter and a WPRE
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hChR2
• Species: Chlamydomonas reinhardtii
• Insert Size (bp): 1661
• Mutation: E123T and T159C
• Promoter: CaMKIIa
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: AGTCCTGCAGTATTGTGTAT
• 3′ sequencing primer: GCAATAGCATGATACAAAGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments