pAAV-Ef1a-DIO hChR2(E123T/T159C)-mCherry
(Plasmid #35510)

• Purpose: AAV expression of Ef1a-driven, cre-dependent, hChR2 variant for ultrafast optogenetic control.
• Depositing Lab: Karl Deisseroth
• Publication: Mattis et al Nat Methods. 2011 Dec 18;9(2):159-72. doi: 10.1038/nmeth.1808.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 5605
• Modifications to backbone: Addition of an Ef1a promoter, lox sites and WPRE
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hChR2
• Species: Chlamydomonas reinhardtii
• Insert Size (bp): 1646
• Mutation: E123T and T159C
• Promoter: Ef1a
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CACCCACACAAAGGAAAAGGGCC
• 3′ sequencing primer: GCAATAGCATGATACAAAGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments