Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-Ef1a-DIO hChR2(E123A)-mCherry
(Plasmid #35508)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35508 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5605
  • Modifications to backbone
    Addition of an Ef1a promoter, lox sites and WPRE
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hChR2
  • Species
    Chlamydomonas reinhardtii
  • Insert Size (bp)
    1646
  • Mutation
    E123A
  • Promoter Ef1a
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CACCCACACAAAGGAAAAGGGCC
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DIO hChR2(E123A)-mCherry was a gift from Karl Deisseroth (Addgene plasmid # 35508 ; http://n2t.net/addgene:35508 ; RRID:Addgene_35508)
  • For your References section:

    Principles for applying optogenetic tools derived from direct comparative analysis of microbial opsins. Mattis J, Tye KM, Ferenczi EA, Ramakrishnan C, O'Shea DJ, Prakash R, Gunaydin LA, Hyun M, Fenno LE, Gradinaru V, Yizhar O, Deisseroth K. Nat Methods. 2011 Dec 18;9(2):159-72. doi: 10.1038/nmeth.1808. 10.1038/nmeth.1808 PubMed 22179551