pAAV-Ef1a-DIO hChR2(C128S/D156A)-mCherry
(Plasmid #35504)

• Purpose: AAV expression of Ef1a-driven, cre-dependent, stabilized step function opsin (SSFO) for optogenetic activation.
• Depositing Lab: Karl Deisseroth
• Publication: Yizhar et al Nature. 2011 Jul 27;477(7363):171-8. doi: 10.1038/nature10360.

Backbone

• Vector backbone: pAAV
• Modifications to backbone: Addition of an EF1a promoter, Lox sites and WPRE
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hChR2(C128S/D156A)-mCherry
• Alt name: SSFO-mCherry
• Species: Chlamydomonas reinhardtii
• Insert Size (bp): 1646
• Mutation: C128S and D156A
• Promoter: Ef1a
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CACCCACACAAAGGAAAAGGGCC
• 3′ sequencing primer: GCAATAGCATGATACAAAGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

ChR2 variant harboring two amino acid substitutions which act to stabilize the conducting state of the channel to deactivate with a time constant of nearly 30 minutes following a brief pulse of activating blue light. Like previously published step function opsins, this stabilized step function opsin (SSFO) may be deactivated using yellow light (590nm). The stabilized open state of the channel allows for both lower power activation, meaning in some circumstances the light delivery system need not penetrate the brain, as well as for behavior in the absence of a tethered laser or other light delivery system.