pAAV-CaMKIIa-hChR2(C128S/D156A)-EYFP
(Plasmid #35501)

• Purpose: AAV expression of CaMKII-driven stabilized step function opsin (SSFO) for optogenetic activation.
• Depositing Lab: Karl Deisseroth
• Publication: Yizhar et al Nature. 2011 Jul 27;477(7363):171-8. doi: 10.1038/nature10360.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5385
• Modifications to backbone: Addition of a CaMKIIa promoter and a WPRE
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hChR2
• Species: Chlamydomonas reinhardtii
• Insert Size (bp): 1661
• Mutation: C128S and D156A
• Promoter: CaMKIIa
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: AGTCCTGCAGTATTGTGTAT
• 3′ sequencing primer: GCAATAGCATGATACAAAGG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

ChR2 variant harboring two amino acid substitutions which act to stabilize the conducting state of the channel to deactivate with a time constant of nearly 30 minutes following a brief pulse of activating blue light. Like previously published step function opsins, this stabilized step function opsin (SSFO) may be deactivated using yellow light (590nm). The stabilized open state of the channel allows for both lower power activation, meaning in some circumstances the light delivery system need not penetrate the brain, as well as for behavior in the absence of a tethered laser or other light delivery system.