pAAV-CaMKIIa-C1V1 (t/t)-TS-mCherry
(Plasmid #35500)

• Purpose: AAV expression of CaMKII-driven chimeric opsin variant C1V1 (E122T/E162T) for fast and potent optical excitation at red-shifted wavelengths.
• Depositing Lab: Karl Deisseroth
• Publication: Yizhar et al Nature. 2011 Jul 27;477(7363):171-8. doi: 10.1038/nature10360.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5385
• Modifications to backbone: Addition of a CaMKIIa promoter and a WPRE
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ChR1-VChR1 Chimera
• Alt name: C1V1 (t/t)
• Species: Synthetic
• Insert Size (bp): 1809
• Mutation: E122T and E162T
• GenBank ID: AEL28923.1
• Promoter: CaMKIIa
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: AGTCCTGCAGTATTGTGTAT
• 3′ sequencing primer: GCAATAGCATGATACAAAGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments