Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry
(Plasmid #35498)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35498 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5590
  • Modifications to backbone
    Addition of Ef1a promoter, Lox sites and a WPRE
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChR1-VChR1 Chimera
  • Alt name
    C1V1 (t/t)
  • Species
    Synthetic
  • Insert Size (bp)
    1809
  • Mutation
    E122T and E162T
  • GenBank ID
    AEL28923.1
  • Promoter Ef1a
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CACCCACACAAAGGAAAAGGGCC
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry was a gift from Karl Deisseroth (Addgene plasmid # 35498 ; http://n2t.net/addgene:35498 ; RRID:Addgene_35498)
  • For your References section:

    Neocortical excitation/inhibition balance in information processing and social dysfunction. Yizhar O, Fenno LE, Prigge M, Schneider F, Davidson TJ, O'Shea DJ, Sohal VS, Goshen I, Finkelstein J, Paz JT, Stehfest K, Fudim R, Ramakrishnan C, Huguenard JR, Hegemann P, Deisseroth K. Nature. 2011 Jul 27;477(7363):171-8. doi: 10.1038/nature10360. 10.1038/nature10360 PubMed 21796121