-
PurposeAAV expression of Ef1a-driven, cre-dependent, chimeric opsin variant C1V1 (E122T/E162T) for fast and potent optical excitation at red-shifted wavelengths.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 35497 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
AAV9 | 35497-AAV9 | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | $405 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5590
-
Modifications to backboneAddition of Ef1a promoter, Lox sites and a WPRE
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChR1-VChR1 Chimera
-
Alt nameC1V1 (t/t)
-
SpeciesSynthetic
-
Insert Size (bp)1818
-
MutationE122T and E162T
-
GenBank IDAEL28923.1
- Promoter Ef1a
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CACCCACACAAAGGAAAAGGGCC
- 3′ sequencing primer GCAATAGCATGATACAAAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Information for AAV9 (Catalog # 35497-AAV9) ( Back to top)
Purpose
Ready-to-use AAV9 particles produced from pAAV-Ef1a-DIO C1V1 (t/t)-TS-EYFP (#35497). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO C1V1 (t/t)-TS-EYFP plasmid DNA.
EFIa-driven, Cre-dependent, C1V1 (t/t) fused to EYFP for optogenetic activation. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
- Buffer PBS + 0.001% Poloxamer 188
- Serotype AAV9
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene EYFP (Cre-dependent)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-DIO C1V1 (t/t)-TS-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 35497 ; http://n2t.net/addgene:35497 ; RRID:Addgene_35497) For viral preps, please replace (Addgene plasmid # 35497) in the above sentence with: (Addgene viral prep # 35497-AAV9) -
For your References section:
Neocortical excitation/inhibition balance in information processing and social dysfunction. Yizhar O, Fenno LE, Prigge M, Schneider F, Davidson TJ, O'Shea DJ, Sohal VS, Goshen I, Finkelstein J, Paz JT, Stehfest K, Fudim R, Ramakrishnan C, Huguenard JR, Hegemann P, Deisseroth K. Nature. 2011 Jul 27;477(7363):171-8. doi: 10.1038/nature10360. 10.1038/nature10360 PubMed 21796121