pAAV-Ef1a-DIO C1V1 (t/t)-TS-EYFP
(Plasmid #35497)

• Purpose: AAV expression of Ef1a-driven, cre-dependent, chimeric opsin variant C1V1 (E122T/E162T) for fast and potent optical excitation at red-shifted wavelengths.
• Depositing Lab: Karl Deisseroth
• Publication: Yizhar et al Nature. 2011 Jul 27;477(7363):171-8. doi: 10.1038/nature10360.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5590
• Modifications to backbone: Addition of Ef1a promoter, Lox sites and a WPRE
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ChR1-VChR1 Chimera
• Alt name: C1V1 (t/t)
• Species: Synthetic
• Insert Size (bp): 1818
• Mutation: E122T and E162T
• GenBank ID: AEL28923.1
• Promoter: Ef1a
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CACCCACACAAAGGAAAAGGGCC
• 3′ sequencing primer: GCAATAGCATGATACAAAGG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Information for AAV9 (Catalog # 35497-AAV9)

Purpose

Ready-to-use AAV9 particles produced from pAAV-Ef1a-DIO C1V1 (t/t)-TS-EYFP (#35497). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO C1V1 (t/t)-TS-EYFP plasmid DNA.

EFIa-driven, Cre-dependent, C1V1 (t/t) fused to EYFP for optogenetic activation. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
• Buffer: PBS + 0.001% Poloxamer 188
• Serotype: AAV9
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: EYFP (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Ancillary Agreement for Penn Vectors
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.