pUG2K
(Plasmid #35493)

• Depositing Lab: Ramesh Shivdasani
• Publication: Horst et al Cancer Res. 2012 Feb 8.

Backbone

• Vector backbone: pUltra
• Backbone manufacturer: Malcom Moore
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KRAS(G12V)
• Species: H. sapiens (human)
• Mutation: G12V
• Entrez Gene: KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
• Promoter: Ubiquitin C

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xba1 (not destroyed)
• 3′ cloning site: BamH1 (not destroyed)
• 5′ sequencing primer: ccactacctgagcacccagt

Resource Information

• A portion of this plasmid was derived from a plasmid made by: We inserted PCR amplified constitutively active KRAS(G12V) from the pBabe K-Ras 12V plasmid (Channing Der) into pUltra.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry