Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FOP-GFP.mC
(Plasmid #35492)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35492 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PGK-H2BmCherry
  • Backbone manufacturer
    Mark Mercola
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    7xFOP-GFP
  • Species
    Synthetic
  • Promoter mutated 7xTCF/LEF

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hpa1 (not destroyed)
  • 3′ cloning site Hpa1 (destroyed during cloning)
  • 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This vector carries promoter with 7 mutated TCF/LEF sequences in front of GFP, inserted into the Hpa1 site of the PGK-H2BmCherry vector.
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the gaps between the Addgene sequencing results and the depositor's full sequence do not alter the plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FOP-GFP.mC was a gift from Ramesh Shivdasani (Addgene plasmid # 35492 ; http://n2t.net/addgene:35492 ; RRID:Addgene_35492)
  • For your References section:

    Differential WNT activity in colorectal cancer confers limited tumorigenic potential and is regulated by MAPK signaling. Horst D, Chen J, Morikawa T, Ogino S, Kirchner T, Shivdasani RA. Cancer Res. 2012 Feb 8. 10.1158/0008-5472.CAN-11-3222 PubMed 22318865