FOP-GFP.mC
(Plasmid #35492)

• Depositing Lab: Ramesh Shivdasani
• Publication: Horst et al Cancer Res. 2012 Feb 8.

Backbone

• Vector backbone: PGK-H2BmCherry
• Backbone manufacturer: Mark Mercola
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 7xFOP-GFP
• Species: Synthetic
• Promoter: mutated 7xTCF/LEF

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Hpa1 (not destroyed)
• 3′ cloning site: Hpa1 (destroyed during cloning)
• 5′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This vector carries promoter with 7 mutated TCF/LEF sequences in front of GFP, inserted into the Hpa1 site of the PGK-H2BmCherry vector.
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the gaps between the Addgene sequencing results and the depositor's full sequence do not alter the plasmid function.