FOP-GFP
(Plasmid #35490)

• Depositing Lab: Ramesh Shivdasani
• Publication: Horst et al Cancer Res. 2012 Feb 8.

Backbone

• Vector backbone: pRRLSIN.cPPT.PGK-GFP.WPRE
• Backbone manufacturer: Didier Trono
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 7xFOP-GFP
• Species: Synthetic
• Promoter: mutated 7xTCF/LEF

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (not destroyed)
• 3′ cloning site: BamH1 (not destroyed)
• 5′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: In this plasmid, a synthetic mutated 7xTCF/LEF promoter sequence replaces the promoter sequence of the 7xTOP-GFP vector.
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry