-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 35395 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMSCV
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersRFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMyc
-
Alt nameC-Myc
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1346
-
GenBank IDNM_010849
-
Entrez GeneMyc (a.k.a. Myc2, Niard, Nird, bHLHe39)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer 5' GGATCCACGACGATGCCCCTCAACGTGAAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRFP
-
Alt namered fluorescent protein
-
SpeciesDiscosoma
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-Myc-IRES-RFP was a gift from Martine Roussel (Addgene plasmid # 35395 ; http://n2t.net/addgene:35395 ; RRID:Addgene_35395) -
For your References section:
A mouse model of the most aggressive subgroup of human medulloblastoma. Kawauchi D, Robinson G, Uziel T, Gibson P, Rehg J, Gao C, Finkelstein D, Qu C, Pounds S, Ellison DW, Gilbertson RJ, Roussel MF. Cancer Cell. 2012 Feb 14;21(2):168-80. 10.1016/j.ccr.2011.12.023 PubMed 22340591