pWPI-FLAG-hPRKCI
(Plasmid #35387)

• Depositing Lab: Luke McCaffrey
• Publication: pWPI-myc-hPRKCI (unpublished)

Backbone

• Vector backbone: pWPI
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 11076
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Protein Kinase C iota
• Alt name: PRKCI
• Alt name: atypical Protein Kinase C
• Species: H. sapiens (human)
• Insert Size (bp): 1820
• GenBank ID: BAG70257.1
• Entrez Gene: PRKCI (a.k.a. DXS1179E, PKCI, nPKC-iota)
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PmeI (destroyed during cloning)
• 3′ cloning site: PmeI (destroyed during cloning)
• 5′ sequencing primer: ACTGGAATCCACCATGGAAC
• 3′ sequencing primer: AAGAATGTGTCTGACAGCTG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the vector backbone, pWPI, is a bicistronic vector that allows for simultaneous expression of a transgene (PRKCI in this case) and an EGFP marker to facilitate tracking of transduced cells. The EGFP marker cDNA has been inserted downstream of EMCV IRES.

The PRKCI insert in this plasmid is a known variant that lack the first nine amino acids of PRKCI when compared to GenBank entry NP_002731.4