pCS2+8CmCherry-ABCC9a
(Plasmid
#35208)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 35208 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCS2+8CmCherry
-
Backbone manufacturerGokirmak et al., 2012
- Backbone size w/o insert (bp) 4866
-
Vector typeMammalian Expression ; Sea urchin, zebrafish, Xenopus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameABCC9a
-
SpeciesStrongylocentrotus purpuratus
-
Insert Size (bp)4773
- Promoter SP6
-
Tag
/ Fusion Protein
- mCherry (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer CTTGATTTAGGTGACACTATA
- 3′ sequencing primer GCCTCCCAGCCCATGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2+8CmCherry-ABCC9a was a gift from Amro Hamdoun (Addgene plasmid # 35208 ; http://n2t.net/addgene:35208 ; RRID:Addgene_35208) -
For your References section:
Localization and Substrate Selectivity of Sea Urchin Multidrug (MDR) Efflux Transporters. Gokirmak T, Campanale JP, Shipp LE, Moy GW, Tao H, Hamdoun A. J Biol Chem. 2012 Nov 2. 10.1074/jbc.M112.424879 PubMed 23124201