nSR100L4
(Plasmid
#35174)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 35174 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1-puro
- Backbone size w/o insert (bp) 7032
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMmnSR100
-
gRNA/shRNA sequenceCCGGGCTCACAGTATATCTCCTAAACTCGAGTTTAGGAGATATACTGTGAGCTTTTTG
-
SpeciesM. musculus (mouse)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer LKO1-5' (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
nSR100L4 was a gift from Benjamin Blencowe (Addgene plasmid # 35174 ; http://n2t.net/addgene:35174 ; RRID:Addgene_35174) -
For your References section:
Regulation of vertebrate nervous system alternative splicing and development by an SR-related protein. Calarco JA, Superina S, O'Hanlon D, Gabut M, Raj B, Pan Q, Skalska U, Clarke L, Gelinas D, van der Kooy D, Zhen M, Ciruna B, Blencowe BJ. Cell. 2009 Sep 4;138(5):898-910. 10.1016/j.cell.2009.06.012 PubMed 19737518