pLKO.1_sh_ex15
(Plasmid
#35166)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 35166 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1
- Backbone size w/o insert (bp) 7000
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFoxp1
-
gRNA/shRNA sequenceGCTAACACTAAACGAAATCTACTCGAGTAGATTTCGTTTAGTGTTAGCTTTTT
-
SpeciesM. musculus (mouse)
-
Entrez GeneFoxp1 (a.k.a. 3110052D19Rik, 4932443N09Rik)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer LKO.1-5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1_sh_ex15 was a gift from Benjamin Blencowe (Addgene plasmid # 35166 ; http://n2t.net/addgene:35166 ; RRID:Addgene_35166) -
For your References section:
An alternative splicing switch regulates embryonic stem cell pluripotency and reprogramming. Gabut M, Samavarchi-Tehrani P, Wang X, Slobodeniuc V, O'Hanlon D, Sung HK, Alvarez M, Talukder S, Pan Q, Mazzoni EO, Nedelec S, Wichterle H, Woltjen K, Hughes TR, Zandstra PW, Nagy A, Wrana JL, Blencowe BJ. Cell. 2011 Sep 30;147(1):132-46. Epub 2011 Sep 15. 10.1016/j.cell.2011.08.023 PubMed 21924763