Skip to main content
Addgene

pLKO-tet-puro-sh-control
(Plasmid #35163)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35163 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO-tet-puro
  • Backbone size w/o insert (bp) 10000
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNAi against GFP#1
  • gRNA/shRNA sequence
    GCAAGCTGACCCTGAAGTTCAT
  • Insert Size (bp)
    55
  • Promoter hPGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer H1
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-tet-puro-sh-control was a gift from Benjamin Blencowe (Addgene plasmid # 35163)
  • For your References section:

    An alternative splicing switch regulates embryonic stem cell pluripotency and reprogramming. Gabut M, Samavarchi-Tehrani P, Wang X, Slobodeniuc V, O'Hanlon D, Sung HK, Alvarez M, Talukder S, Pan Q, Mazzoni EO, Nedelec S, Wichterle H, Woltjen K, Hughes TR, Zandstra PW, Nagy A, Wrana JL, Blencowe BJ. Cell. 2011 Sep 30;147(1):132-46. Epub 2011 Sep 15. 10.1016/j.cell.2011.08.023 PubMed 21924763